ASFVdb The African Swine Fever Virus Database
Strain
Poland_Pol17_05838_C220_2016-2017 (Region: Poland;  Strain: Pol17_05838_C220;  Date: 2016-2017)
Gene
hypothetical protein ASFV_Kyiv_2016_131_00059
Description
With frameshift mutation but translatable,  hypothetical protein
GenBank Accession
Full name
Probable helicase A859L       + More
Helicase ATP-binding domain-containing protein      
 

Sequence

CDS
ATGACCACCAATCCTGTCTTTATTGCAAAACGGATACGGGAGGCCCCTTCTCTTCTTGTGATTGCCACCTACCAATCCTCCACGCTACTGGTGGATGATTTCGATCTTATTATTAGCGATGAATGTCACCGGATTTGCGGCGAATGGGAGACACGGCCCTTTACCCACGTGTTGCTCAACTTTAAAAAAGGGCACCGACTTTTTTTAACGGCAACGCCCAGGTACGACACCCCGCTTTCCATGAAAAATCGTGAACTTTTTGGCGGCGTTGCCTTTCGCTACTATCTGCGAGAAGGCATAGAGGCCGGCTATGTAAATGATTTTGAATTGCAGATGGTAGCCGCGCCTAAATTGGCCCACCAACCGAGTACCAAAGAGGAGACCACGAAACAGATCATAGTAAAGCAAATTATAATGGCCTTAGCCTATTTAAAAACCAATATACCGGCTCCTAAAATGCTGGTATTTACCCGTGATATTAAACAGGCCAAGGAGCTATACGCGGCGTTGGTAGACCAAGGGGTCTATGCCCTGATAGCTCACTCAACCCTGCCGCGACAGGTTATCCTCAAAACATTTACAGAATTTTGTTCCTCAAAGGAACCCGTTATTTTATTAAACTGTCGACTCTTTCAAGAGGGCGTAGAGGTTCCAGAACTAAACGCGGTATTTTTTGCAGCGCCGCGACATAGTCCTAGAGACATTATTCAAAGCATATGCAGACCGCTGAACAAGCAGGTTCAAAAGCCTCACGCAACCATTTTTCTACCTTTAGAAGTAAACACAGAAAACGTATGTCTAGACAGGTTTTCTAGCATTATCCCCTTTGCAGACGCCTTGGCATCTGAAGATCCACGCTTTTACGAGCATCTTTTAAACCCTTCGGAGGTTGCCTATCCGATAAACTGGATCGGGGCCCACGGATCGGTGTCAGAATTGTTGCAATTGGCACGACATGCCATACGCTATGGCACGCAGGGCAAAATAGACCGTCTTACCCGCAGCGAAAGACTTCCTTGGAAGGCCGCTTTTGCAGAACTCAAACGTACGGTTGAAATATGTTGCAGATATCCTAAAATCAACGACGGCTTTCACTTTGGAGGCGCCACGCTGCGGTTCGACACATGGTATAAATGGGTCATTAAATCTTATTTGCAGTACAAAAACAAGGAACCGTCTTCTTTAGAGCCTTACCAGGTGTCGGACCTGGAGTCCTTGCAAGATTGGACAACCCGTGGTGTTGGCGGGCCTTATCCCTGGGAAGAAAGCATGGCATTCTTGGAAACTTGGCTTGCCCAAAATAAAGGAGAGCTTGTTGCCATTGATATTCATCAGGGTGGATGGATAGGATTAGATGCGACGCCCATGGAAAGACTATCAGGCGTCCTAACCACTGTTTCGCAACGCGATGGCCGAAGCTATGGAAAAAATAAAAAGCTTCGACCTAAAAAGGGATTTATGATTCCACCCCAGCAGGCGCAAGATCTTGATCGCATTTTTGGAAAGCACAATCTTAAGTGGAGAAAGGACAGGGTTAATGGCTTTTTAAAGGAAGATGAACATGGAAATTATACCGGTGAGCCTACCTGTATTCAAGAAGCCTATCGGACCTTTAAAGAATACGTAAAAACAAACCCTGAATATATCGAAAAATACTGGCCTGGTTATGCCAAAGGCAAGCATAAACACCAAGAATTACCGCACATATGGGAAAAGGGCCTGGCTCCTCCCCGCTATAAGGCATTTAAAGATGGTAATAAACAGCTTATCCAAAGAAGTCCGAAAAAAAAGGACATTAAAAATTAA
Protein
MTTNPVFIAKRIREAPSLLVIATYQSSTLLVDDFDLIISDECHRICGEWETRPFTHVLLNFKKGHRLFLTATPRYDTPLSMKNRELFGGVAFRYYLREGIEAGYVNDFELQMVAAPKLAHQPSTKEETTKQIIVKQIIMALAYLKTNIPAPKMLVFTRDIKQAKELYAALVDQGVYALIAHSTLPRQVILKTFTEFCSSKEPVILLNCRLFQEGVEVPELNAVFFAAPRHSPRDIIQSICRPLNKQVQKPHATIFLPLEVNTENVCLDRFSSIIPFADALASEDPRFYEHLLNPSEVAYPINWIGAHGSVSELLQLARHAIRYGTQGKIDRLTRSERLPWKAAFAELKRTVEICCRYPKINDGFHFGGATLRFDTWYKWVIKSYLQYKNKEPSSLEPYQVSDLESLQDWTTRGVGGPYPWEESMAFLETWLAQNKGELVAIDIHQGGWIGLDATPMERLSGVLTTVSQRDGRSYGKNKKLRPKKGFMIPPQQAQDLDRIFGKHNLKWRKDRVNGFLKEDEHGNYTGEPTCIQEAYRTFKEYVKTNPEYIEKYWPGYAKGKHKHQELPHIWEKGLAPPRYKAFKDGNKQLIQRSPKKKDIKN

Summary

Similarity
Belongs to the asfivirus helicase A859L family.
Keywords
ATP-binding   Complete proteome   Helicase   Hydrolase   Nucleotide-binding   Reference proteome  
Feature
chain  Probable helicase A859L
EMBL
FR682468    CBW46706.1    MG939583    MG939587    MG939588    AXZ95816.1    + More
AXZ96004.1    AXZ96099.1    AY261363    AY261366    LS478113    SPS73463.1    AM712239    CAN10139.1    FN557520    CBH29141.1    AM712240    CAN10388.1    KM262844    KM262845    KM102979    KP055815    KX354450    AIY22231.1    AIY22390.1    AJZ77050.1    AKO62722.1    AOO54370.1    U18466    MN194591    QED21595.1    AY261361    KM111294    AJL34054.1    AY261360    KM111295    AJL34219.1    MH025916    MH025917    MH025918    MH025919    MH025920    AXB49269.1    AXB49443.1    AXB49615.1    AXB49786.1    AXB49959.1    HE575323    CCC94274.1    HF955125    CCW65814.1    LS997630    SYZ68202.1    CP009400    AIO00599.1    CALQ01001382    CCM17777.1    FR799006    CAM42427.1    FR799583    CBZ29061.1    CP029530    AYU81185.1    UINB01000031    SUZ44206.1    FR796463    CAM70323.1    RHLD01000005    TPP41621.1    FR799618    CBZ36408.1    RHLC01000006    TPP42773.1    ATMG01010879    EPY27205.1    AHKC01011967    EKF30546.1    ATMG01003987    EPY39939.1    LGTL01000032    KPA74015.1    PRFC01000359    PWU90645.1    FR796427    CAJ08152.1    NBCO01000003    ORC92770.1    PRFA01000058    PWU89540.1    AYLP01000041    ESS66650.1    AAHK01001763    EAN84209.1    PRFC01000144    PWV04781.1    MKKU01000023    RNF26928.1    MKGL01000442    RNE98701.1    AAHK01001120    EAN86926.1    QSBY01000010    RHW69379.1    FN554973    CBH16385.1    CZPT02000209    SCU65038.1    CM000208    EAN78608.1    AUPL01000464    ESL11778.1    LJSK01000007    KPI90361.1    ATMH01009351    ATMH01006855    ATMH01006372    ATMH01002372    ATMH01000607    EPY19648.1    EPY25075.1    EPY25998.1    EPY33256.1    EPY36395.1    ATMH01007630    EPY23604.1    HF955212    CCW71644.1    HE573026    CCC52156.1    FXEG02000002    SOX53839.1    SLVY01000006    TCN53370.1    VKAA01000022    TRW79285.1    LQIL01000001    KUH91864.1    NOZH01000002    OZE43162.1    CP000552    ABM71246.1    LTCZ01000066    KXX60900.1    QTTW01000006    REF15038.1    JANZ01000008    EUA08625.1    UPHU01000001    VBA48749.1    LZSW01000010    OBB77877.1    CP019420    AQA04894.1    LZIF01000074    OBF65975.1    CSTD01000002    CPR10900.1    AJJH01000157    EID75326.1    SOIG01000498    TET95271.1    NOYA01000035    OZC55568.1    MLIS01000001    OHU77030.1    JNAM01000002    KGF98901.1    UPHL01000125    VAZ85581.1    LZKP01000161    OBI75882.1    MK500433    QBK89660.1    CP019882    AQT80276.1    NHBZ02000014    RPF84212.1    LN831039    CKI51574.1    NCXO01000032    OSC32810.1    VMQU01000158    TVS83096.1    OZE43160.1    FZNT01000002    SNR39223.1    SRLQ01000003    TGD89224.1    MVHN01000025    ORA44543.1    LZLK01000077    OBJ87468.1    AQT81508.1    FTQU01000001    SIU03354.1    LZLB01000010    OBJ34102.1    NHCQ01000092    OUU26378.1    NHJG02000010    RPG88344.1    LZHT01000041    OBF05342.1    PUTX01001013    PQP39737.1    AOSR01000043    EYT60945.1    SIU03352.1    AFVW02000004    EJO88062.1    NOZM01000005    OZE68040.1    LADQ01000260    KJS08562.1   
Pfam
PF00271   Helicase_C
PF04851   ResIII
PF10544   T5orf172
PF03457   HA
PF13156   Mrr_cat_2
PF18135   Type_ISP_C
PF02384   N6_Mtase
Interpro
IPR018306   Phage_T5_Orf172_DNA-bd
IPR027417   P-loop_NTPase
IPR001650   Helicase_C
IPR014001   Helicase_ATP-bd
IPR006935   Helicase/UvrB_N
IPR036770   Ankyrin_rpt-contain_sf
IPR020683   Ankyrin_rpt-contain_dom
IPR002110   Ankyrin_rpt
IPR005114   Helicase_assoc
IPR011335   Restrct_endonuc-II-like
IPR039442   Mrr-like_dom
IPR002052   DNA_methylase_N6_adenine_CS
IPR041635   Type_ISP_LLaBIII_C
IPR029063   SAM-dependent_MTases
IPR003356   DNA_methylase_A-5
SUPFAM
SSF52540   SSF52540
SSF48403   SSF48403
SSF52980   SSF52980
SSF53335   SSF53335
Gene 3D
PDB
5FFJ     E-value=9.67346e-18,     Score=225

Ontologies

KEGG

Subcellular Location

From MSLVP
Nucleus

Topology

Length:
601
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0757999999999999
Exp number, first 60 AAs:
0.01512
Total prob of N-in:
0.00508
outside
1  -  601
 
 

Population Genetic Test Statistics

Pi
0.0290165
Theta
0.0352706
Tajima's D
-0.6229662
CLR
0
Interpretation
No evidence of Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 

Orthologous in Strains

Strain Availability Status Gene
Spain_BA71_1971 Protein
Protein
QED21595.1
AKO62722.1
China_AnhuiXCGQ_2018 Protein
Protein
QED21595.1
AYW34012.1
China_ASFV-SY18_2018 Protein
AKO62722.1
Poland_Pol16_20186_o7_2016-2017 Protein
Protein
QED21595.1
AXZ95816.1
Poland_Pol16_20538_o9_2016-2017 Protein
Protein
CAN10139.1
QED21595.1
Poland_Pol16_20540_o10_2016-2017 Protein
Protein
CAN10139.1
QED21595.1
Poland_Pol16_29413_o23_2016-2017 Protein
Protein
CAN10139.1
QED21595.1
Poland_Pol17_03029_C201_2016-2017 Protein
Protein
QED21595.1
AXZ96004.1
Poland_Pol17_04461_C210_2016-2017 Protein
Protein
QED21595.1
AXZ96099.1
Poland_Pol17_05838_C220_2016-2017 Protein
Protein
CAN10139.1
QED21595.1
Poland_ASFV_POL_Podlaskie_2015 Protein
Protein
CAN10139.1
QED21595.1
Uganda_R8_2015 Protein
Protein
QED21595.1
AXB49269.1
Uganda_R7_2015 Protein
Protein
QED21595.1
AXB49443.1
Uganda_R25_2015 Protein
Protein
QED21595.1
AXB49615.1
Uganda_N10_2015 Protein
Protein
QED21595.1
AXB49786.1
Uganda_R35_2015 Protein
Protein
QED21595.1
AXB49959.1
Estonia_2014 Protein
Protein
QED21595.1
SPS73463.1
Italy_26544_OG10_2010 Protein
Protein
QED21595.1
AJZ77050.1
Italy_47_Ss_2008_2008 Protein
Protein
QED21595.1
AOO54370.1
Portugal_OURT_88.3_1988 Protein
Protein
QED21595.1
CAN10388.1
Spain_E75_1975 Protein
Protein
QED21595.1
CBH29141.1
Russia_Georgia_2007 Protein
Protein
QED21595.1
CBW46706.1
Kenya_Tk1_2005 Protein
Protein
QED21595.1
AJL34054.1
Kenya_Bus_2006 Protein
Protein
QED21595.1
AJL34219.1
Russia_Odintsovo_2014 Protein
Protein
CAN10139.1
QED21595.1
Portugal_L60_1960 Protein
Protein
QED21595.1
AIY22231.1
Portugal_NHV_1968 Protein
Protein
QED21595.1
AIY22390.1
Russia_Kashino_2013 Protein
Protein
CAN10139.1
QED21595.1
Benin_1997 Protein
Protein
Protein
CAN10139.1
QED21595.1
CAN10139.1
South_Africa_KNP_Pretorisuskop_1996 Protein
Protein
CAN10139.1
QED21595.1
South_Africa_MGR_Mkuzi_1979 Protein
Protein
CAN10139.1
QED21595.1
Malawi_Lil_1983 Protein
CAN10139.1
Kenya_1950 Protein
Protein
CAN10139.1
QED21595.1
Namibia_Warthog_1980 Protein
Protein
CAN10139.1
QED21595.1
South_Africa_Warmbaths_1987 Protein
Protein
CAN10139.1
QED21595.1
Malawi_Tengani_1962 Protein
Protein
CAN10139.1
QED21595.1
China_HLJ_2018 Protein
Protein
QED21595.1
QBH90528.1
China_LN_2018 Protein
Protein
QED21595.1
QBH90713.1
China_wbBS01_2018 Protein
Protein
QED21595.1
QDL88071.1
Ukraine_Kyiv_2014 Protein
QED21596.1
Belgium_Etalle_wb_2018 Protein
Protein
QED21595.1
QED90483.1
Lithuania_LT14_2014 Protein
Protein
QED21595.1
QEY87846.1
South_Africa_1985 Protein
CAN10139.1
South_Africa_2_2008 Protein
CAN10139.1
Zambia_LIV_1983 Protein
CAN10139.1
Copyright@ 2018-2023    Any Comments and suggestions mail to:  zhuzl@cqu.edu.cn, mg@cau.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号

In processing...
Login to ASFVdb
Email
Password
Please go to Regist if without an account.
If you have forgotten your password, you can once again Regist an account with a registed or new email.
Change my password
Enter new password
Reenter new password
Regist an account of ASFVdb
It is required that you provide your institutional e-mail address (with edu or org in the domain) as confirmation of your affiliation.
Enter email
Reenter email
First Name
Last Name
Institution
You can directly go to if with an account.
Registraion Success
Your password has been sent to your email.
Please check it and login later.
Welcome to use ASFVdb.