ASFVdb The African Swine Fever Virus Database
Strain
Malawi_Tengani_1962 (Region: Malawi, Tengani, Nsanje District;  Strain: Tengani 62;  Date: 1962)
Gene
BA71V-B962L
Description
With frameshift mutation but translatable,  similar to African swine fever virus E75 strain E75 of INSD accession FN557520
GenBank Accession
Full name
Putative RNA Helicase B962L       + More
Putative RNA helicase B962L      
 

Sequence

CDS
ATGGGAAAACCGACTTTATTGGAGCCTGGTCATCTCTATAACGTGCCCGCTGAGCACAAGAATGATGTTCCTATTCATTACATCATCACTTGGATAAAACAACGTCTCCCGGAGTTTGGAGGGGCCATTCCAACCTCTCTCGCAGACCGGGTGCTCATTATAAAGTCACGCACTGGATCCGGAAAATCCACGGCCCTACCCGTACACGTGTTCAGAATTCTGAGAAATGAAAACACGCATTCTTTCCAAAAATATTTGGGACGCTCGGTTATTTGTACCCAGCCAAGAGTCCTAACCGCGGTGACCCTCGCCAAAGACATCGGCGCCTCAACCCACTACCCCGACATGATATTAGGCCAAACAGTGGGCTACCAGACGAAGCCTCTGACGGAAAAACCCAATCGGGGCCTTATCTACGCAACCGCGGGGGTTCTGTTGGCGCAGCTACATACAATGACGGATGATGAGATAGCTTCCCGCTATGCCTTTATGATTATAGATGAGGCCCATGAGCGAGCCCTAGGCATCGACCTTATGCTCATGTATATTAAAAGTATGCTTCAGCGCATGTTGCAAAGAGGAAGCATAGGGGCGCTGCGTATTCCCTTTGTAATTTTAACCTCCGCCACCATTGATACTCATAAATACTCAACCTATTTTGGTATCGGAAAAGAAAACATTATTTTGGTGGAAGGACGACAGTACGGTGTGGAAACCCACTGGCCGCTGTATAACACCAACAACTACATTAAGACCGCCTGCGAAACGGCTCTCACTATTCATAAAGAAAACATTCATGATCGTCCCACGGAAGCAGATATTTTAATTTTCATGCCCGGTATGGCTGAAATACGCTTCCTTTCGATGTTGCTGAATAATGCAAATATGGACCTTGCCAAAGAAAAGCTGCCGTTAATGTTGATTTTGCCGATCGATAGTGAGGCGATTGCGCAGGAAAATGAGGCCTACCTTGGCCTAAAAGCGGAAATTAAGAATCTTTGGGTGAAAAATCCCTTAACCGCTAAAGTGGAAAAACCTTTAAGAAGGGTCATCGTTTCCACGGTTGTTGCGGAAACGGGCCTTACCATTGAAACGCTGAAGTACGTCATAGATCCCGGCTGGAACAGAAGCATTGAAACCTACTACCCCGAATGGGCGGGAGGGCTCATTACGCGCCCCGCGGCTCAAAGTCGTATCGAGCAAAGAAAGGGGCGTGTAGGGAGAGTATTTCCTGGGCACTTTTACCCGCTTTACACAAAACACGTCTTTGAGCAAATACCAGTGCAGCAGTATCCTGAAATCATTACGGAAGGCCCTGGGGCCATTTTTCTTAGCATTGTCGTAGAAACGATTAAAAAAAATAAGGAAGGCGTGTTTAAAGCAGAGGAGATTGATATGCTGGATCCTCCCCCCACGGATGCGCTGGCATCAGCCATTGAGCGGGCCATTGTGGCAGGCCTTTTAACCAGAGGAGAAAAAGGTCTTCAACTCACGCAGCTCGGAGACATTGCCTCTCGCTTTTCGTTTTTATCTATAGAAGAAGCGCGCATGTGTTTTTCGGGTTATTTCTGGCAAGCCGCCATTTCTGACATTGCAACCATCCTAGCCGTCGTGTCTGTTGCGGACAAAAAACTTACGAATCTATTGGACAGTAAACAACGGAATGGAGCTATGCTTGCTGAAGCGGTTTTGGCAGGCATTCCGCCGTTTCTACAAAATATTGACAATGCTTACACCAACATCCACCTTTTATTGGCAGATGATCTTTTGGAGGGGCTCTTTATTTTTGAAGGCTTCCAACATGCCATCGTATATTTTATCAATAATAAGGTTAATAATGTAGCTAAACATCTTCGCGAATGGTGCGAAAAAAAAATGCTAAAATATTCTTCTATGGTGCAGATCTTAGCGCGCCGCGAAGATATTTTAAACGAGCTGGCCATTGTAGGATTGAACCCCTTCCACCAATGGCAAAACCGCTTGGCCTCCGCCAATGCAGAAACCTTTTTAAAACGTGTTTGTATTTTGAAACAGTGTATGTATGAGGCGTATCGCCTTAATTGTTTCTGCTACGACGAACATAGGCTTCTTTATACTGGAAGAAATGGAATACACTTTTCTTACCACGATGCGGTGATTAAAAACCCTTCGTGCATTGTGACGCCTAGGATTATGCTATCTCCCGTTTCTAAACAGTATATGGAATGGAGATTAGAGCCAAGCTTTGTGTCCGTCCTCGATGGATTCGTAAACGTGGACATAAACTTTCTTTTGCCGCGTCAGGAAATTCCAAATATTTTGGGAGGCGCCGAGGACGAAGAGGAGGAGCCCCCTCTGCCCATTCAGGTATTTTTACATAAATACGTAAAGACCCATTTTCACTTCTCCGGGAAATCCTTTAAAGAGTTGAAAATGAAGCCTGGCCAGACGATTAAGTTTCCCGAAACAACCTTAATCAACATGATTCCCGATATACCTAAAAACGTAGTTCAAACCTATTTGGAAATAAATGTTTGCCATCAATACTCGTTTAAGCGTCTCATTTACTGTGAAACGTTTTATACCGATATGGATGACGTCCAGCATGAAAACTCTGTGGAGCTCATAGGGTTACCTATGGCGGCGCATCATCTTACGATAAACGATTTTAACAAGCTTTACCATCTGTTGAAACCTGATGGTTTTCTTATCGTGTATGACCTTCACCAAAGTCAGGAAGCCTTCTGGCTTCACAGCCTGCAGGATGCGCTTGGGCACCATACTATTCGTAGAGACATGGAATTCCATACCATCCCCGAATGGGAAACCATATTTAATGAATGCGGGTTCACACCGATTTTTAGTAAACAGCCTTCGGGGCACGAACTGTTCATCGTATTTAAAAAATAA
Protein
MGKPTLLEPGHLYNVPAEHKNDVPIHYIITWIKQRLPEFGGAIPTSLADRVLIIKSRTGSGKSTALPVHVFRILRNENTHSFQKYLGRSVICTQPRVLTAVTLAKDIGASTHYPDMILGQTVGYQTKPLTEKPNRGLIYATAGVLLAQLHTMTDDEIASRYAFMIIDEAHERALGIDLMLMYIKSMLQRMLQRGSIGALRIPFVILTSATIDTHKYSTYFGIGKENIILVEGRQYGVETHWPLYNTNNYIKTACETALTIHKENIHDRPTEADILIFMPGMAEIRFLSMLLNNANMDLAKEKLPLMLILPIDSEAIAQENEAYLGLKAEIKNLWVKNPLTAKVEKPLRRVIVSTVVAETGLTIETLKYVIDPGWNRSIETYYPEWAGGLITRPAAQSRIEQRKGRVGRVFPGHFYPLYTKHVFEQIPVQQYPEIITEGPGAIFLSIVVETIKKNKEGVFKAEEIDMLDPPPTDALASAIERAIVAGLLTRGEKGLQLTQLGDIASRFSFLSIEEARMCFSGYFWQAAISDIATILAVVSVADKKLTNLLDSKQRNGAMLAEAVLAGIPPFLQNIDNAYTNIHLLLADDLLEGLFIFEGFQHAIVYFINNKVNNVAKHLREWCEKKMLKYSSMVQILARREDILNELAIVGLNPFHQWQNRLASANAETFLKRVCILKQCMYEAYRLNCFCYDEHRLLYTGRNGIHFSYHDAVIKNPSCIVTPRIMLSPVSKQYMEWRLEPSFVSVLDGFVNVDINFLLPRQEIPNILGGAEDEEEEPPLPIQVFLHKYVKTHFHFSGKSFKELKMKPGQTIKFPETTLINMIPDIPKNVVQTYLEINVCHQYSFKRLIYCETFYTDMDDVQHENSVELIGLPMAAHHLTINDFNKLYHLLKPDGFLIVYDLHQSQEAFWLHSLQDALGHHTIRRDMEFHTIPEWETIFNECGFTPIFSKQPSGHELFIVFKK

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Similarity
Belongs to the DEAD box helicase family. DEAH subfamily.
Keywords
ATP-binding   Complete proteome   Helicase   Host membrane   Hydrolase   Membrane   Nucleotide-binding   Transmembrane   Transmembrane helix   Reference proteome  
Feature
chain  Putative RNA Helicase B962L
Pfam
PF00270   DEAD
PF00271   Helicase_C
Interpro
IPR011545   DEAD/DEAH_box_helicase_dom
IPR027417   P-loop_NTPase
IPR029063   SAM-dependent_MTases
IPR014001   Helicase_ATP-bd
IPR001650   Helicase_C
IPR002464   DNA/RNA_helicase_DEAH_CS
SUPFAM
SSF53335   SSF53335
SSF52540   SSF52540
PDB
5Y88     E-value=1.15094e-42,     Score=440

Ontologies

KEGG

Subcellular Location

From MSLVP
Single-Pass Membrane
From Uniprot
Host membrane  

Topology

Length:
962
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13987
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00161
outside
1  -  962
 
 

Population Genetic Test Statistics

Pi
0.0276597
Theta
0.0386839
Tajima's D
-0.9730229
CLR
0
Interpretation
No evidence of Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 

Orthologous in Strains

Strain Availability Status Gene
Spain_BA71_1971 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AKO62754.1
China_AnhuiXCGQ_2018 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AYW34044.1
China_ASFV-SY18_2018 Protein
AKO62754.1
Poland_Pol16_20186_o7_2016-2017 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AXZ95847.1
Poland_Pol16_20538_o9_2016-2017 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Poland_Pol16_20540_o10_2016-2017 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Poland_Pol16_29413_o23_2016-2017 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Poland_Pol17_03029_C201_2016-2017 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AXZ96035.1
Poland_Pol17_04461_C210_2016-2017 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AXZ96130.1
Poland_Pol17_05838_C220_2016-2017 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Poland_ASFV_POL_Podlaskie_2015 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Uganda_R8_2015 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AXB49301.1
Uganda_R7_2015 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AXB49475.1
Uganda_R25_2015 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AXB49647.1
Uganda_N10_2015 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AXB49818.1
Uganda_R35_2015 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AXB49991.1
Estonia_2014 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
SPS73496.1
Italy_26544_OG10_2010 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AJZ77048.1
Italy_47_Ss_2008_2008 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AOO54411.1
Portugal_OURT_88.3_1988 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
CAN10422.1
Spain_E75_1975 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
CBH29174.1
Russia_Georgia_2007 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
CBW46739.1
Kenya_Tk1_2005 Protein
Protein
Genetic Remain
Protein
AJL34086.1
QED21648.1
QED21650.1
AJL34086.1
Kenya_Bus_2006 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AJL34251.1
Russia_Odintsovo_2014 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Portugal_L60_1960 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AIY22264.1
Portugal_NHV_1968 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
AIY22422.1
Russia_Kashino_2013 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Benin_1997 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
CAN10172.1
South_Africa_KNP_Pretorisuskop_1996 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
South_Africa_MGR_Mkuzi_1979 Protein
Protein
AJL34086.1
QED21648.1
Malawi_Lil_1983 Genetic Remain
Protein
Protein
AJL34086.1
QED21648.1
QED21650.1
Kenya_1950 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Namibia_Warthog_1980 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
South_Africa_Warmbaths_1987 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Malawi_Tengani_1962 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
China_HLJ_2018 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
QBH90561.1
China_LN_2018 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
QBH90746.1
China_wbBS01_2018 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
QDL88104.1
Ukraine_Kyiv_2014 Protein
Protein
Protein
QED21646.1
QED21647.1
QED21649.1
Belgium_Etalle_wb_2018 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
QED90516.1
Lithuania_LT14_2014 Protein
Genetic Remain
Protein
QED21648.1
QED21650.1
QEY87879.1
South_Africa_1985 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
South_Africa_2_2008 Protein
Protein
Genetic Remain
AJL34086.1
QED21648.1
QED21650.1
Zambia_LIV_1983 Protein
Genetic Remain
QED21648.1
QED21650.1
Copyright@ 2018-2023    Any Comments and suggestions mail to:  zhuzl@cqu.edu.cn, mg@cau.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号

In processing...
Login to ASFVdb
Email
Password
Please go to Regist if without an account.
If you have forgotten your password, you can once again Regist an account with a registed or new email.
Change my password
Enter new password
Reenter new password
Regist an account of ASFVdb
It is required that you provide your institutional e-mail address (with edu or org in the domain) as confirmation of your affiliation.
Enter email
Reenter email
First Name
Last Name
Institution
You can directly go to if with an account.
Registraion Success
Your password has been sent to your email.
Please check it and login later.
Welcome to use ASFVdb.