ASFVdb The African Swine Fever Virus Database
Strain
South_Africa_KNP_Pretorisuskop_1996 (Region: South Africa, Kruger National Park;  Strain: Pretorisuskop/96/4;  Date: 1996)
Gene
Guanylyltransferase
Description
Annoated by sequence mapping,  structural protein
GenBank Accession
Full name
Probable mRNA-capping enzyme      
 

Sequence

CDS
ATGGCTTCTTTAGATAATTTAGTGGCACGATATCAGAGGTGCTTTAATGACCAGTCTCTCAAAAATAGTACTATTGAACTTGAAATACGTTTTCAACAGATAAATTTTTTATTATTCAAAACCGTATATGAGGCACTTGTGGCACAAGAGATCCCTAGCACCATCTCCCACAGCATCCGTTGCATCAAAAAAGTTCACCATGAAAACCACTGCCGGGAAAAAATTTTGCCGTCGGAGAATTTTTACTTCAAAAAACAGCCTCTCATGTTTTTTAAGTTTTCAGAGCCTGCATCTCTGGGCTGTAAGGTCTCGCTGGCCATCGAGCAGCCCATTCGTAAATTTATCTTGGACTCCTCCGTTCTCGTTCGGCTCAAAAATCGTACGACCTTCCGGGTATCTGAACTTTGGAAAATAGAGCTTACCATTGTAAAGCAGCTGATGGGAAGCGAGGTCTCTGCAAAACTTACCGCCTTCAAAACGCTCCTGTTTGACACCCCAGAGCAACAAACGACAAAAAATATGATGTCGTTAATAAACCCAGATGACGAATATCTTTATGAAATAGAAATAGAGTATACAGGAAAGCCCGAATCCCTAACGGCGGCAGATGTTATAAAAATTAAAAACACGGTGTTGACACTTATTTCTCCGAACCATTTAATGCTAACAGCCTACCACCAGGCCATTGAATTCATTGCCTCCCATATACTGTCCTCAGAAATCCTTCTTGCACGTATTAAGAGCGGGAAGTGGGGGCTTAAACGCCTCCTTCCCCAGGTGAAATCCATGACCAAAGCGGATTACATGAAATTTTATCCGCCTGTTGGTTACTATATAACGGACAAAGCAGATGGAATTAGAGGCATCGCCGTCATTCAGGACACACAAATTTATGTGGTTGCAGACCAGCTTTACAGCCTAGGTACCACCGGCATTGAACCCCTTAAACCAACCATTTTGGACGGTGAATTTATGCCTGAAAAAAAAGAATTTTATGGGTTTGATGTCATCATGTATGAGGGCAATCTATTGACGCAACAGGGGTTTGAAACAAGAATTGAGACTTTAAGCAAGGGCATTAAAGTCTTACAAGCGTTTAACATAAAAGCAGAAATGAAGCCCTTTATTTCGCTAACAAGTGCAGATCCCAACGTGCTCCTCAAAAACTTTGAAAGCATTTTTAAGAAAAAAACTCGCCCGTATTCTATTGATGGCATCATTTTAGTAGAACCTGGCAATTCTTATCTAAATACAAACACTTTTAAGTGGAAGCCCACCTGGGATAACACATTAGACTTTTTGGTGCGAAAATGTCCAGAGAGTTTAAACGTACCAGAGTACGCGCCCAAAAAAGGGTTTTCCCTGCATCTACTATTTGTAGGCATTTCCGGAGAGCTTTTCAAGAAATTAGCGCTAAATTGGTGTCCAGGATACACGAAACTATTCCCCGTTACACAGCGCAACCAAAACTACTTTCCAGTACAGTTCCAGCCATCGGATTTTCCATTGGCATTTCTTTATTACCACCCAGATACCTCGTCATTTTCTGATATAGATGGAAAGGTCCTTGAAATGCGTTGTCTTAAGAGAGAAATCAATCACGTCAGCTGGGAAATTGTAAAAATCCGGGAGGATAGGCAGCAGGATCTTAAAACCGGCGGGTATTTTGGCAATGATTTCAAAACAGCCGAACTTACATGGCTTAACTATATGGATCCCTTTTCCTTTGAGGAGCTGGCAAAGGGCCCCTCTGGAATGTACTTCGCCGGTGCCAAAACCGGCATATACCGCGCTCAAACAGCACTTATTTCCTTTATTAAGCAAGAAATCATCCAAAAAATAAGTCACCAATCCTGGGTTATCGATCTTGGAATAGGAAAGGGGCAGGACCTAGGACGTTACTTGGACGCAGGGGTAAGGCATCTTGTTGGGATCGATAAGGATCAAACCGCGCTCGCGGAGCTTGTTTATCGAAAGTTTTCGCATGCTACAACCCGACAGCACAAGCACGCTACCAACATTTATGTGTTGCATCAAGACCTCGCAGAGCCTGCGAAGGAAATCAGCGAAAAGGTACACCAAATTTACGGGTTTCCCAAGGAGGGAGCTTCTTCCATTGTTAGCAACCTGTTTATTCACTATCTTATGAAAAACACGCAGCAGGTGGAAAACCTGGCCGTTCTGTGCCATAAGCTTCTTCAGCCGGGGGGAATGGTGTGGTTTACCACCATGCTGGGAGAACGGGTCTTAGAATTACTTCATGAAAATAGAATAGAGCTCAATGAAGTATGGGAAGCACGTGAAAACGAGGTGGTCAAATTTGCTATTAAACGTCTCTTTAAAGAGGATATATTACAGGAAACTGGGCAAGAAATTGGAGTCTTGTTACCCTTCAGCAATGGCGACTTCTACAATGAGTATCTTGTGAACACGGCGTTTTTAATTAAAATATTTAAACATCACGGATTTTCCCTGGTCCAAAAGCAGTCCTTTAAGGACTGGATTCCAGAATTTCAAAACTTTAGTAAAAGTTTGTATAAAATTCTTACAGAAGCCGATAAAACTTGGACAAGCCTTTTTGGGTTTATTTGTCTGCGCAAAAATTAA
Protein
MASLDNLVARYQRCFNDQSLKNSTIELEIRFQQINFLLFKTVYEALVAQEIPSTISHSIRCIKKVHHENHCREKILPSENFYFKKQPLMFFKFSEPASLGCKVSLAIEQPIRKFILDSSVLVRLKNRTTFRVSELWKIELTIVKQLMGSEVSAKLTAFKTLLFDTPEQQTTKNMMSLINPDDEYLYEIEIEYTGKPESLTAADVIKIKNTVLTLISPNHLMLTAYHQAIEFIASHILSSEILLARIKSGKWGLKRLLPQVKSMTKADYMKFYPPVGYYITDKADGIRGIAVIQDTQIYVVADQLYSLGTTGIEPLKPTILDGEFMPEKKEFYGFDVIMYEGNLLTQQGFETRIETLSKGIKVLQAFNIKAEMKPFISLTSADPNVLLKNFESIFKKKTRPYSIDGIILVEPGNSYLNTNTFKWKPTWDNTLDFLVRKCPESLNVPEYAPKKGFSLHLLFVGISGELFKKLALNWCPGYTKLFPVTQRNQNYFPVQFQPSDFPLAFLYYHPDTSSFSDIDGKVLEMRCLKREINHVSWEIVKIREDRQQDLKTGGYFGNDFKTAELTWLNYMDPFSFEELAKGPSGMYFAGAKTGIYRAQTALISFIKQEIIQKISHQSWVIDLGIGKGQDLGRYLDAGVRHLVGIDKDQTALAELVYRKFSHATTRQHKHATNIYVLHQDLAEPAKEISEKVHQIYGFPKEGASSIVSNLFIHYLMKNTQQVENLAVLCHKLLQPGGMVWFTTMLGERVLELLHENRIELNEVWEARENEVVKFAIKRLFKEDILQETGQEIGVLLPFSNGDFYNEYLVNTAFLIKIFKHHGFSLVQKQSFKDWIPEFQNFSKSLYKILTEADKTWTSLFGFICLRKNX

Summary

Function
Catalyzes the second reaction in the mRNA cap formation pathway.
Catalytic Activity
a 5'-triphospho-(purine-ribonucleotide)-[mRNA] + H2O = a 5'-diphospho-(purine-ribonucleotide)-[mRNA] + H(+) + phosphate
a 5'-diphospho-(purine-ribonucleotide)-[mRNA] + GTP + H(+) = a 5'-(5'-triphosphoguanosine)-(purine-ribonucleotide)-[mRNA] + diphosphate
a 5'-(5'-triphosphoguanosine)-(purine-ribonucleotide)-[mRNA] + S-adenosyl-L-methionine = a 5'-(N(7)-methyl 5'-triphosphoguanosine)-(purine-ribonucleotide)-[mRNA] + S-adenosyl-L-homocysteine
Similarity
In the N-terminal section; belongs to the dsDNA virus mRNA guanylyltransferase family.
In the C-terminal section; belongs to the class I-like SAM-binding methyltransferase superfamily. mRNA cap 0 methyltransferase family.
Keywords
Complete proteome   GTP-binding   Hydrolase   Methyltransferase   mRNA capping   mRNA processing   Nucleotide-binding   Nucleotidyltransferase   RNA-binding   S-adenosyl-L-methionine   Transferase   Reference proteome  
Feature
chain  Probable mRNA-capping enzyme
Pfam
PF01331   mRNA_cap_enzyme
PF03291   Pox_MCEL
Interpro
IPR029063   SAM-dependent_MTases
IPR004971   mRNA_G-N7_MeTrfase_dom
IPR033469   CYTH-like_dom_sf
IPR001339   mRNA_cap_enzyme
SUPFAM
SSF53335   SSF53335
SSF55154   SSF55154
PDB
2HV9     E-value=6.37495e-06,     Score=123

Ontologies

KEGG

Subcellular Location

From MSLVP
Single-Pass Membrane

Topology

Length:
869
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02018
Exp number, first 60 AAs:
0.00206
Total prob of N-in:
0.00044
outside
1  -  869
 
 

Population Genetic Test Statistics

Pi
0.0280567
Theta
0.0386839
Tajima's D
-0.8972481
CLR
0
Interpretation
No evidence of Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 

Orthologous in Strains

Strain Availability Status Gene
Spain_BA71_1971 Protein
AKO62782.1
China_AnhuiXCGQ_2018 Protein
AYW34072.1
China_ASFV-SY18_2018 Protein
AKO62782.1
Poland_Pol16_20186_o7_2016-2017 Protein
AXZ95875.1
Poland_Pol16_20538_o9_2016-2017 Protein
CAN10200.1
Poland_Pol16_20540_o10_2016-2017 Protein
CAN10200.1
Poland_Pol16_29413_o23_2016-2017 Protein
CAN10200.1
Poland_Pol17_03029_C201_2016-2017 Protein
CAN10200.1
Poland_Pol17_04461_C210_2016-2017 Protein
AXZ96158.1
Poland_Pol17_05838_C220_2016-2017 Protein
CAN10200.1
Poland_ASFV_POL_Podlaskie_2015 Protein
CAN10200.1
Uganda_R8_2015 Protein
AXB49329.1
Uganda_R7_2015 Protein
AXB49503.1
Uganda_R25_2015 Protein
AXB49675.1
Uganda_N10_2015 Protein
AXB49846.1
Uganda_R35_2015 Protein
AXB50019.1
Estonia_2014 Protein
SPS73524.1
Italy_26544_OG10_2010 Protein
AJZ77049.1
Italy_47_Ss_2008_2008 Protein
AOO54458.1
Portugal_OURT_88.3_1988 Protein
CAN10450.1
Spain_E75_1975 Protein
CBH29201.1
Russia_Georgia_2007 Protein
CBW46767.1
Kenya_Tk1_2005 Protein
AJL34114.1
Kenya_Bus_2006 Protein
AJL34279.1
Russia_Odintsovo_2014 Protein
CAN10200.1
Portugal_L60_1960 Protein
AIY22292.1
Portugal_NHV_1968 Protein
AIY22450.1
Russia_Kashino_2013 Protein
CAN10200.1
Benin_1997 Protein
Protein
CAN10200.1
CAN10200.1
South_Africa_KNP_Pretorisuskop_1996 Protein
CAN10200.1
South_Africa_MGR_Mkuzi_1979 Protein
CAN10200.1
Malawi_Lil_1983 Protein
CAN10200.1
Kenya_1950 Protein
CAN10200.1
Namibia_Warthog_1980 Protein
CAN10200.1
South_Africa_Warmbaths_1987 Protein
CAN10200.1
Malawi_Tengani_1962 Protein
CAN10200.1
China_HLJ_2018 Protein
QBH90589.1
China_LN_2018 Protein
QBH90774.1
China_wbBS01_2018 Protein
QDL88132.1
Ukraine_Kyiv_2014 Protein
QED21701.1
Belgium_Etalle_wb_2018 Protein
QED90544.1
Lithuania_LT14_2014 Protein
QEY87907.1
South_Africa_1985 Protein
QGM12928.1
South_Africa_2_2008 Protein
QGM12854.1
Zambia_LIV_1983    
Copyright@ 2018-2023    Any Comments and suggestions mail to:  zhuzl@cqu.edu.cn, mg@cau.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号

In processing...
Login to ASFVdb
Email
Password
Please go to Regist if without an account.
If you have forgotten your password, you can once again Regist an account with a registed or new email.
Change my password
Enter new password
Reenter new password
Regist an account of ASFVdb
It is required that you provide your institutional e-mail address (with edu or org in the domain) as confirmation of your affiliation.
Enter email
Reenter email
First Name
Last Name
Institution
You can directly go to if with an account.
Registraion Success
Your password has been sent to your email.
Please check it and login later.
Welcome to use ASFVdb.