ASFVdb The African Swine Fever Virus Database
Strain
Russia_Georgia_2007 (Region: Russia;  Strain: Georgia 2007/1;  Date: 2007)
Gene
G1340L
Description
Annotated in NCBI,  product contains ATP- or GTP-binding motif
GenBank Accession
Full name
Uncharacterized protein G1340L      
 

Sequence

CDS
ATGGATTTCCAAAATGACTTTTTAACAAATCCTCTACGAGTTACTCTTTATAATCCTGTGGAAAATGAGTACACGAAGACGTTTATTTTTTTGGGATCCGTTCCTGCAAACGTGTTACAGGCCTGCCGCAAAGACCTGCAGCGAACCCCTAAGGACAAAGAAATTTTACAAAATTTTTACGGCGAGGATTGGGAGAAAAAGCTTTCCCAATACGTGGTGGGTGGAGATAGCGATGATTTAGATGAGTTTGAAAAACTTTTTGTGGAGGATCGTGGCGAGGAGACAAACGTGATGATGCCAGAAATTGAGACGATGTATAGCGAGTATAGTATTTTCCCTGAAGACACTTTTAAAGACATTCGAGAAAAAATTTACGTTGCCACAGGGATCCCCCCTTATAGACAACACATTTTCTTTTTTCAAAACAATGCGCTTCAGGTAACGTATCGCCTATTGTTAAGCGGTAGCGGGGTGGCGTTAGACATTCGCGACTACAAAAAGGAGTTTCAACAGGTGGGTGGGGTGAACATCGACGCATCTATGGAAAGTCAAAAAGATGAGCTCTATGTGGAAGCGCTCGACAGCTTCCAGCTCATAAAAAACATTCATCACATCTTTGTAGCAGACCTCAACACGCTAGTGGCCCCCATGCGGCGCCAAATCTCCATTGCCATAGAGGATAATTACCAATTTGACTTACTCTATTACGGCCTTATTATGAAGTATTGGCCTCTTCTTTCCCCCGATGCCTTTAAACTATTGGTACAATCTCCCTTACAAATGGAAAAACAGTATCCTGCTCTTTCTCCATCCTTGACCAGTCTTAAAAAGAGGCTTCTCCTAGAGCAAAAACTAATAAACTTTACGTATGCCAGAGCACAACAAGTCATTGCCAAGTACGAGGGGAATAGACTAACACGCGGCACGTTGGCCGTCACCTCGGCAATGATTAAAATTTCACCCCTCGTAAATATTCAAATTAATGTGCGCAATGTTTTCGACCTATTTCCAGCTACTCCCGATATTCCTCAGCTGGTGGTGTTCTTTTATAGTAAAACAGGTCCCACCGTGGTTTCCAAACACCACATAACTTCCACGGAGCCTGAAAAATTCAGCAATAAAACATTCCGTGTACCCACTATTATTTTAATACGCTTTATCAATAAAAAGGCCTTTATTCTTACCATACAAAATAATGGGCACTACTTTATCGAAAGCAATTGGTCAGAAAACGAGCGCCACGACTTTAACTCCGTGGTGTCCACCCTAAATAATTTCATAAATCCTATTATTCATACAATTAATGATATGGGGCCTGCCGCGTTTCCTCGTGGAGGGAGTCTGCCCCTTCCCTCCAACGAGGACATCCAAATTTCTATCAGCTCCATGTCGGTGTCCACCTTTTGGCCCTATACGCTTTCTAGCAAGGGATTTACCGAGCTCAAAAGTCGTTGGCGGGAATACGAGCAAGCAGGGATTATTTCCGTGCGGGGCCTCCAGCAAACCGGGGTCTACAATTTTTTATTTAAAAAGGGGATTTATTCGTATGATCCCCACGAAATCGAACGGATGATCATTATTTCCTCCGGTCCGGGGCGCAAAATGGACATCAATGTTGCGTTGCTCCAAAACACGTATGCGTACCTCTTTGACACAAATGTTGCGGCCCGGTGGGAAACAATCTACGGCGGCCGCAACATTCGCATCTACCATAGGGTTACAGATATCAAAATAGAAATGTTTAACATTACCCAGGAAGAGTTTAACTATCTTTGGGTTTACCTATTTGTGTTTTTAGATAACTTGATCACCGGGCCTGACAAAATTTTGGTTAATAAACTCTCTCAACTGCACGATAAACAACAAGGAAAGGGAGCCTCTCAGCTACGTGCGCTTCAAGAACAGGACCCCGACCTGTATGACCTGCGCAAGTACGACACGCAGGCAACGGTTTACTCCGTCCTATGCCAGCACCCACGGCCACCCGTCATTTACTCAGAGGCCGAGGTGAAGTCCATGCCGCCAGCCAAGCGCAAGGAGCTAGTAAAGTATTGGAATTTCACGGAGGGGGTACCTGCCTACTATAGCTGCCCGCATCCTGACTACCCTCATCTAAGCCTACTAGAAGGCCGCCACCCCCTAAATTACTGTCTGCCGTGCTGCCAAAAGACGAAGGCCCTGCTGGGCACAAAGCGGTTCTATATTAACAATACCTGCCTCACCAAGCACACGTTTGTAGAACAAGACCTGGAGGATCTTAATACACAAACATCGCGTCATACCTTGTCCTATGGAAAAAAAATACCGGTGAACCGGATTGCCTTTCTACCCCACCAGATAGCAGATGAACTGTTTTTAAATACGATAAAAGAGCCCGACATTTTTTGCATTGTGGGGGTGGAGCAAACCATGCTTGGAATTAGCAATGCCGGGCTTTTTTATTCCCTTGCTCGAATTTTGGATCTTGCCCCCAAGGCCCTTGCCATTGAAATTGCAAAGGCGGCCAACACACCGCAGTACTATATTTTGGGGAATGGGGCCGGCAACATGTTTTCCAGCGGCGCGGAGCTGGCAAACCTTATCTTACAAACCTTTGTTGAACAAAAAAACCAACTGCTTCAATGGGACACCACATGGCAGGACATCTTTCTGGACCTTGTTGCCATATGCTACGACCTTCACTGTGTCTTTTTTAAAGATAAACAGGGCGACATCGGGTTTGAGGTGTCCCCCAGCACAATACAAAAAATTCTTAGCCCATCGAAGAAGATAGCCATTATCTTTGACACGGACGAAGGGATCTACCCAATGGCCATCACCCAGCAAAAAAGATTTCTGAAAAACAGTGAGGCCCAGTATATTTTTACCGAAGATGACCCTGTGATGGAGGTCATCCAGTCTATGAGCGAGTTTATGTGCAAGGATAACTGGTGGGATATCCATGACGTGAAAAACATTCCCGGCTACACGGTTGGTAAAAAACTTATCAACAGGCATAACTTTTGTTATGCTTTACTTATCGATTCAGACACCGATCGCCCTATTTATTTTCCTATAAGACTATCATCCTACATTCATGACGACATTCCCATCGACTTTGATCTGCGGCCCACCCAGATTGCAAGCTTTGAAGAAACCTGGAAATTTATTACCCTTTTCAACAAACAGTATAAACAGTACGAAATCGTACCCTCAGCGGTGCTGCAAAATATAAAAAAAGAATTTGTGGGCTTTCTTTCAGAGGGAAAAACCGGGCTATACTTTTACTACGCTCCAACCCAAACTCTTCCCGCTACGCTGGAAAAGCTTCCCATCGCAACATTGACTATTGATCCTAGGGATATAGACCAAGCCATTCTATATCCCCTAGAGGAACCATATCCTCAGCAGAATAAGGCCAACAAAGCTTTTTATATTAACCATTTGTATAAGTTTTTGCTGATTGAATTTTTTGATGTCTTGTATGGACTGCAAAGCAACTCAACCCGCAAACACATTGAAAATCTTTTTCAAAAAACCGATTTCCAGAAAATAACCTCCGTCACCGAGTTCTACACAAAGCTGTCAGACTTTGTAGATTTAAATGACATTCATACCATAAAACATATTTTGGAAACCACGGACGCGGAACATGCTTTAAAGGTTCTTCAAAAAAACATTTTTAACTTTGACTACACCCTTCTTTCCCCCCTCCAGTCCTACACGTATGATGAGTTATGTCAACATCTTAAAAAACTTTTGACGCCGCGCATTGAATTCTATGAAGATATTGAAACCATCGACCGCGGTCTTATTAATATATATACCTCCTGCCAGTATTCGACCCTAAACCAACCGCAGTGCAAAAAAAAACGCTTACGCATTCCTGTAAACCACTTTGAAAATTATATTCACATTCTTGCGGCGGATATTTTAAATCCCTTAAAACATAGTACTCTACTTTTAACAGGTCTGGGCGTTATAGATGACCTACAGTTTATATTGCGGCCGCAGGAAATTATTAGTGTAAAAAATAAGTTTTAA
Protein
MDFQNDFLTNPLRVTLYNPVENEYTKTFIFLGSVPANVLQACRKDLQRTPKDKEILQNFYGEDWEKKLSQYVVGGDSDDLDEFEKLFVEDRGEETNVMMPEIETMYSEYSIFPEDTFKDIREKIYVATGIPPYRQHIFFFQNNALQVTYRLLLSGSGVALDIRDYKKEFQQVGGVNIDASMESQKDELYVEALDSFQLIKNIHHIFVADLNTLVAPMRRQISIAIEDNYQFDLLYYGLIMKYWPLLSPDAFKLLVQSPLQMEKQYPALSPSLTSLKKRLLLEQKLINFTYARAQQVIAKYEGNRLTRGTLAVTSAMIKISPLVNIQINVRNVFDLFPATPDIPQLVVFFYSKTGPTVVSKHHITSTEPEKFSNKTFRVPTIILIRFINKKAFILTIQNNGHYFIESNWSENERHDFNSVVSTLNNFINPIIHTINDMGPAAFPRGGSLPLPSNEDIQISISSMSVSTFWPYTLSSKGFTELKSRWREYEQAGIISVRGLQQTGVYNFLFKKGIYSYDPHEIERMIIISSGPGRKMDINVALLQNTYAYLFDTNVAARWETIYGGRNIRIYHRVTDIKIEMFNITQEEFNYLWVYLFVFLDNLITGPDKILVNKLSQLHDKQQGKGASQLRALQEQDPDLYDLRKYDTQATVYSVLCQHPRPPVIYSEAEVKSMPPAKRKELVKYWNFTEGVPAYYSCPHPDYPHLSLLEGRHPLNYCLPCCQKTKALLGTKRFYINNTCLTKHTFVEQDLEDLNTQTSRHTLSYGKKIPVNRIAFLPHQIADELFLNTIKEPDIFCIVGVEQTMLGISNAGLFYSLARILDLAPKALAIEIAKAANTPQYYILGNGAGNMFSSGAELANLILQTFVEQKNQLLQWDTTWQDIFLDLVAICYDLHCVFFKDKQGDIGFEVSPSTIQKILSPSKKIAIIFDTDEGIYPMAITQQKRFLKNSEAQYIFTEDDPVMEVIQSMSEFMCKDNWWDIHDVKNIPGYTVGKKLINRHNFCYALLIDSDTDRPIYFPIRLSSYIHDDIPIDFDLRPTQIASFEETWKFITLFNKQYKQYEIVPSAVLQNIKKEFVGFLSEGKTGLYFYYAPTQTLPATLEKLPIATLTIDPRDIDQAILYPLEEPYPQQNKANKAFYINHLYKFLLIEFFDVLYGLQSNSTRKHIENLFQKTDFQKITSVTEFYTKLSDFVDLNDIHTIKHILETTDAEHALKVLQKNIFNFDYTLLSPLQSYTYDELCQHLKKLLTPRIEFYEDIETIDRGLINIYTSCQYSTLNQPQCKKKRLRIPVNHFENYIHILAADILNPLKHSTLLLTGLGVIDDLQFILRPQEIISVKNKF

Summary

Similarity
Belongs to the asfivirus G1340L family.
Keywords
Complete proteome   Reference proteome  
Feature
chain  Uncharacterized protein G1340L
PDB
5O6S     E-value=2.31373,     Score=76

Ontologies

KEGG

Subcellular Location

From MSLVP
Capsid

Topology

Length:
1340
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05295
Exp number, first 60 AAs:
0.00179
Total prob of N-in:
0.00060
outside
1  -  1340
 
 

Population Genetic Test Statistics

Pi
0.0281371
Theta
0.0375471
Tajima's D
-0.9640912
CLR
0
Interpretation
No evidence of Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 

Orthologous in Strains

Strain Availability Status Gene
Spain_BA71_1971 Protein
AKO62770.1
China_AnhuiXCGQ_2018 Protein
AYW34060.1
China_ASFV-SY18_2018 Protein
AKO62770.1
Poland_Pol16_20186_o7_2016-2017 Protein
AXZ95863.1
Poland_Pol16_20538_o9_2016-2017 Protein
CAN10188.1
Poland_Pol16_20540_o10_2016-2017 Protein
CAN10188.1
Poland_Pol16_29413_o23_2016-2017 Protein
CAN10188.1
Poland_Pol17_03029_C201_2016-2017 Protein
AXZ96051.1
Poland_Pol17_04461_C210_2016-2017 Protein
AXZ96146.1
Poland_Pol17_05838_C220_2016-2017 Protein
CAN10188.1
Poland_ASFV_POL_Podlaskie_2015 Protein
CAN10188.1
Uganda_R8_2015 Protein
AXB49317.1
Uganda_R7_2015 Protein
AXB49491.1
Uganda_R25_2015 Protein
AXB49663.1
Uganda_N10_2015 Protein
AXB49834.1
Uganda_R35_2015 Protein
AXB50007.1
Estonia_2014 Protein
SPS73512.1
Italy_26544_OG10_2010 Protein
AJZ77040.1
Italy_47_Ss_2008_2008 Protein
AOO54430.1
Portugal_OURT_88.3_1988 Protein
CAN10438.1
Spain_E75_1975 Protein
CBH29189.1
Russia_Georgia_2007 Protein
CBW46755.1
Kenya_Tk1_2005 Protein
AJL34102.1
Kenya_Bus_2006 Protein
AJL34267.1
Russia_Odintsovo_2014 Protein
CAN10188.1
Portugal_L60_1960 Protein
AIY22280.1
Portugal_NHV_1968 Protein
AIY22438.1
Russia_Kashino_2013 Protein
CAN10188.1
Benin_1997 Protein
Protein
CAN10188.1
CAN10188.1
South_Africa_KNP_Pretorisuskop_1996 Protein
CAN10188.1
South_Africa_MGR_Mkuzi_1979    
Malawi_Lil_1983 Protein
CAN10188.1
Kenya_1950 Protein
CAN10188.1
Namibia_Warthog_1980 Protein
CAN10188.1
South_Africa_Warmbaths_1987 Protein
CAN10188.1
Malawi_Tengani_1962 Protein
CAN10188.1
China_HLJ_2018 Protein
QBH90577.1
China_LN_2018 Protein
QBH90762.1
China_wbBS01_2018 Protein
QDL88120.1
Ukraine_Kyiv_2014 Protein
Protein
Protein
QED21676.1
QED21677.1
QED21678.1
Belgium_Etalle_wb_2018 Protein
QED90532.1
Lithuania_LT14_2014 Protein
QEY87895.1
South_Africa_1985    
South_Africa_2_2008    
Zambia_LIV_1983    
Copyright@ 2018-2023    Any Comments and suggestions mail to:  zhuzl@cqu.edu.cn, mg@cau.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号

In processing...
Login to ASFVdb
Email
Password
Please go to Regist if without an account.
If you have forgotten your password, you can once again Regist an account with a registed or new email.
Change my password
Enter new password
Reenter new password
Regist an account of ASFVdb
It is required that you provide your institutional e-mail address (with edu or org in the domain) as confirmation of your affiliation.
Enter email
Reenter email
First Name
Last Name
Institution
You can directly go to if with an account.
Registraion Success
Your password has been sent to your email.
Please check it and login later.
Welcome to use ASFVdb.