ASFVdb The African Swine Fever Virus Database
Strain
Belgium_Etalle_wb_2018 (Region: Belgium;  Strain: Belgium/Etalle/wb/2018;  Date: 2018)
Gene
F1055L
Description
Annotated in NCBI,  NA
GenBank Accession
Full name
Putative helicase/primase complex protein      
 

Sequence

CDS
ATGCAAGAAACATTCAAGTTTCTTCGCTGTAACTCCCAAGGAGAAGCCGTAGAGGATAAATATTCTCTCGAAACCTTAAAGAATCACTTCGTGGTGCGAGATGAATATAATAATCTTTTTAGAGTTTTTTCAAGTCGTGATGACTTTTGGGAGTGGGAGGCGGCTCAGCCCTTTGAGCAGAAGTGTTTCCACGAAGTGGTATTTGGGTTTTTGCCTCAGCGCTTAAAATTTGACATCGACTTTCCGGTAAATAAGTCATACTCTGATGACAATGTTGATGACAATGATAATGTCGAAGACAATGTCTATGACATCCTTGACATGATAATTAACGTCATCATGGATGTATTTTACGAGACATATTCTTTACCTTATAACATCAATCTAACGCGTGAACAAATTTTGCTAACAGATTCTATCGGATTAAATAAAAAGCGAGAACTTAAATACTCCTTTCATATCATACTTTATACATACTCAGTATTAAACAATAATGAGGCCAAAGTCTTTACATCCAAAGTGTTAGAAAATCTTCCCAAACACGTTTATCCTTTTGTTGACCCCCAGGTCAACAAAAGTATTCAAAATTTTCGCATCATAGGGTCTCATAAAAAAGGTAGCATGCGTGTTAAAATGTTTAATGAGGAGCTTGCAGAGGTGTTTGAGACCAGTACAACCACGAAAAAGAGTGATACCCTTATAGCAACCCCCTTTGAAACGACGTGTTTACCTTGTATCTTCACAAATGTAAAAGAAACAACACCGAGTTCCTGCGATACTATCCAACAAAGTGAACTTGAAGAGGTATTAAAATTTGCAGGAACACTATGTAAAAATCATTGCTTCCTCCGTGTTCATAAAAATTTAGTATTGTTTAAACGTACAAGTCCAAGTTACTGCGAAATATGTAAGCGTATGCATGATAAGGACAATACCCTAATTTTAAGAGTCACGGGAAACAAAGTGTATCAACACTGTCGCCATGACAATAAACATAGCCTTCTCATGGGCAGCCTTTCCGGCACAAATAATTTTGTGGAAACATATGTGGACCAAGTGATGACAAAGAGCATAGAGGTTCATGAGTCCATTCTCTTTGAAGAACTGCCTGATACTCAAAAACACATCTATGATGAAAGTAGTATGCGAGAATATGAACGAGTCCCTACGCTTGTTGTAAAGGCTCAAATGAAAATAGGTAAAACCGTCCAACTGCGCAACTATTTGCAAAAATACTACGGCAATAATTCTATTTCAAAACAACAAACCATACGGTTTGTGACGTTTCGACAGATCTTCTCAAAAAATATACAATCCCGGCTACCGAATTTCACATTGTACAGCGAAGTAACTGGAGATTTGGACAGCTACGAAAGAGTCATCATTCAGGTAGAATCACTTTTCCGGCTAACCTCCACAGCCGAGCCTGTAGACCTACTTATTTTGGATGAGGTAGAATCGATTTTTAATCAATTCAATAGCGGCCTGCACAAATACTTTGCTCCCTCTTTTGCCATTTTCATGTGGATGCTCGAAACGGCAAATTATGTTATATGCTTGGACGCAAACCTAGGAAATCGAACGTATAATATTCTACAGCGTTTTCGCGGGGATGTCCCTATCTTCTTTCACTGGAATCAATATAAAAGGGCCCAGCATGACACGTATTATTTTACCTCTTCACGAGAAACTTGGTTAAATAACCTTTTAAAGGATTTGCTAGAAGACAAAAAAATTGTTATCCCTACAAATTCATTAATGGAGGCCCGGCTGTTGCAATCATTTATCCAAAAAAAGTTTCCGGAAAAAAAAATTGGGTTTTATAGTTCTAAAAGCACTGCTCATGAACGGGAATCCCATTTTAATAATGTATCGTATTATTGGGGGCTCGTTGATATCCTTATCTATACGCCCACGATTTCAGCGGGTGTTTCATACGAAGATAAGAGATTTGATGTTTTATACGGCTTTTTTAACAATATGTCGTGTGACGTAGAAACATGTTGCCAAATGTTGGGCCGCGTGCGTGAATTAAAAAGTAAGTGTTATAAAATCTGCTTACAGGGGAAACAAAATTACTATCCAGAAACCATCGAAGACATTGAAATGTTTACGTTACAAAAACGTGACACCCTTTTTCAGACCATAAGCAATCACCAGCTTTCCTTCACGTATAGTAAGGAAACAGGTAGGCCGATATATTATAAAACTCCATACTACCATCTATGGCTCGAAACAATGCGGATACAACATCTATCAAAAAATCACTTTATAACCCGATTTATTAACCAGATCGCCGACACCGGCGCTAAGGTGTTTATACTGACGGGTGAAAAGCTGGAGACAGTCAAACAATATACAAGCATTAAAATGGAAATTAAACACCAGGACTATGTAAACATTGCCTCGGCTGAAACCATTGATGCCAATAAAGCTTTACAAATTAAACAAAACTTAAAGGAAGGCATCACAGTAGACCAGCAAGACCTATTTGCGTATGAAAAGTATAAACTACTCGAATTTTATGCATGGCACGGTCATAAAATTACTCCCAAATTTGTTGAACAATACAATAGTTTTATGACAAAACAGAACTATACTGGCCGTGTCCAAATAAGCCGCGGAAAGACAGTATACGAGTCGCTCACTATGTTACAAACTCAGGAATTAAACTTTCATCAATGGGCCATGCAACACGCAGAGCATCATGATCTACAATTTAATTATAGTTTTCAATCTCATATGTACGCTATTATGCTATTAACTAAGTGCGGCTTTAAATGCGTTCAGGACCCTAATATATTGACCAATGAACAATTAATGACGAAACTCGTTGATGAATTTGTTCAGTATGATTTAAGCGCGATCAGCTTTGAGTTTAAGCTTAAAAAGCCCAATAAAACGGACCCTCAAACAATTTTAAAATTCATTAATAAAGTACTGGGACTACGCTATGGTCTTAAAATTCATCACAACAAGGGTAATTACTACATTAAAAATACGAAAGCAGGTAGTTTGATTCCCTTTGTGAGACAGCAGATTAAGCAGAGTCCTTGCGTTGTTTCAAACCTCTTGCCCATAACAGAGACTTCCTCGGCAAAGGAAGAGACGTCACCCATAAAGGAAGAGACATTTACAGAGACATGA
Protein
MQETFKFLRCNSQGEAVEDKYSLETLKNHFVVRDEYNNLFRVFSSRDDFWEWEAAQPFEQKCFHEVVFGFLPQRLKFDIDFPVNKSYSDDNVDDNDNVEDNVYDILDMIINVIMDVFYETYSLPYNINLTREQILLTDSIGLNKKRELKYSFHIILYTYSVLNNNEAKVFTSKVLENLPKHVYPFVDPQVNKSIQNFRIIGSHKKGSMRVKMFNEELAEVFETSTTTKKSDTLIATPFETTCLPCIFTNVKETTPSSCDTIQQSELEEVLKFAGTLCKNHCFLRVHKNLVLFKRTSPSYCEICKRMHDKDNTLILRVTGNKVYQHCRHDNKHSLLMGSLSGTNNFVETYVDQVMTKSIEVHESILFEELPDTQKHIYDESSMREYERVPTLVVKAQMKIGKTVQLRNYLQKYYGNNSISKQQTIRFVTFRQIFSKNIQSRLPNFTLYSEVTGDLDSYERVIIQVESLFRLTSTAEPVDLLILDEVESIFNQFNSGLHKYFAPSFAIFMWMLETANYVICLDANLGNRTYNILQRFRGDVPIFFHWNQYKRAQHDTYYFTSSRETWLNNLLKDLLEDKKIVIPTNSLMEARLLQSFIQKKFPEKKIGFYSSKSTAHERESHFNNVSYYWGLVDILIYTPTISAGVSYEDKRFDVLYGFFNNMSCDVETCCQMLGRVRELKSKCYKICLQGKQNYYPETIEDIEMFTLQKRDTLFQTISNHQLSFTYSKETGRPIYYKTPYYHLWLETMRIQHLSKNHFITRFINQIADTGAKVFILTGEKLETVKQYTSIKMEIKHQDYVNIASAETIDANKALQIKQNLKEGITVDQQDLFAYEKYKLLEFYAWHGHKITPKFVEQYNSFMTKQNYTGRVQISRGKTVYESLTMLQTQELNFHQWAMQHAEHHDLQFNYSFQSHMYAIMLLTKCGFKCVQDPNILTNEQLMTKLVDEFVQYDLSAISFEFKLKKPNKTDPQTILKFINKVLGLRYGLKIHHNKGNYYIKNTKAGSLIPFVRQQIKQSPCVVSNLLPITETSSAKEETSPIKEETFTET

Summary

Similarity
Belongs to the asfivirus F1055L family.
Keywords
Complete proteome   DNA replication   Reference proteome  
Feature
chain  Putative helicase/primase complex protein
Pfam
PF02399   Herpes_ori_bp
Interpro
IPR027417   P-loop_NTPase
IPR003450   Replication_origin-bd
SUPFAM
SSF52540   SSF52540
PDB
5A9J     E-value=1.87827,     Score=77

Ontologies

KEGG

Subcellular Location

From MSLVP
Capsid

Topology

Length:
1048
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.93432
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00056
outside
1  -  1048
 
 

Population Genetic Test Statistics

Pi
0.0399568
Theta
0.0500616
Tajima's D
-0.6420974
CLR
0.00821
Interpretation
No evidence of Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 

Orthologous in Strains

Strain Availability Status Gene
Spain_BA71_1971 Protein
AKO62729.1
China_AnhuiXCGQ_2018 Protein
AYW34019.1
China_ASFV-SY18_2018 Protein
AKO62729.1
Poland_Pol16_20186_o7_2016-2017 Protein
AXZ95823.1
Poland_Pol16_20538_o9_2016-2017 Protein
AJL34061.1
Poland_Pol16_20540_o10_2016-2017 Protein
AJL34061.1
Poland_Pol16_29413_o23_2016-2017 Protein
AJL34061.1
Poland_Pol17_03029_C201_2016-2017 Protein
AXZ96011.1
Poland_Pol17_04461_C210_2016-2017 Protein
AXZ96106.1
Poland_Pol17_05838_C220_2016-2017 Protein
AJL34061.1
Poland_ASFV_POL_Podlaskie_2015 Protein
AJL34061.1
Uganda_R8_2015 Protein
AXB49276.1
Uganda_R7_2015 Protein
AXB49450.1
Uganda_R25_2015 Protein
AXB49622.1
Uganda_N10_2015 Protein
AXB49793.1
Uganda_R35_2015 Protein
AXB49966.1
Estonia_2014 Protein
SPS73470.1
Italy_26544_OG10_2010 Protein
AJZ77046.1
Italy_47_Ss_2008_2008 Protein
AOO54378.1
Portugal_OURT_88.3_1988 Protein
CAN10395.1
Spain_E75_1975 Protein
CBH29148.1
Russia_Georgia_2007 Protein
CBW46713.1
Kenya_Tk1_2005 Protein
Protein
AJL34061.1
AJL34061.1
Kenya_Bus_2006 Protein
AJL34226.1
Russia_Odintsovo_2014 Protein
AJL34061.1
Portugal_L60_1960 Protein
AIY22238.1
Portugal_NHV_1968 Protein
AIY22397.1
Russia_Kashino_2013 Protein
AJL34061.1
Benin_1997 Protein
CAN10146.1
South_Africa_KNP_Pretorisuskop_1996 Protein
AJL34061.1
South_Africa_MGR_Mkuzi_1979 Protein
AJL34061.1
Malawi_Lil_1983 Protein
AJL34061.1
Kenya_1950 Protein
AJL34061.1
Namibia_Warthog_1980 Protein
AJL34061.1
South_Africa_Warmbaths_1987 Protein
AJL34061.1
Malawi_Tengani_1962 Protein
AJL34061.1
China_HLJ_2018 Protein
QBH90535.1
China_LN_2018 Protein
QBH90720.1
China_wbBS01_2018 Protein
QDL88078.1
Ukraine_Kyiv_2014 Protein
Protein
QED21604.1
QED21605.1
Belgium_Etalle_wb_2018 Protein
QED90490.1
Lithuania_LT14_2014 Protein
QEY87853.1
South_Africa_1985    
South_Africa_2_2008    
Zambia_LIV_1983    
Copyright@ 2018-2023    Any Comments and suggestions mail to:  zhuzl@cqu.edu.cn, mg@cau.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号

In processing...
Login to ASFVdb
Email
Password
Please go to Regist if without an account.
If you have forgotten your password, you can once again Regist an account with a registed or new email.
Change my password
Enter new password
Reenter new password
Regist an account of ASFVdb
It is required that you provide your institutional e-mail address (with edu or org in the domain) as confirmation of your affiliation.
Enter email
Reenter email
First Name
Last Name
Institution
You can directly go to if with an account.
Registraion Success
Your password has been sent to your email.
Please check it and login later.
Welcome to use ASFVdb.